diff options
Diffstat (limited to 'src/galaxy')
| -rw-r--r-- | src/galaxy/multifasta2otu.xml | 6 | ||||
| -rw-r--r-- | src/galaxy/quikr.xml | 20 | ||||
| -rw-r--r-- | src/galaxy/quikr_train.xml | 18 |
3 files changed, 5 insertions, 39 deletions
diff --git a/src/galaxy/multifasta2otu.xml b/src/galaxy/multifasta2otu.xml index b80f8b2..eebe246 100644 --- a/src/galaxy/multifasta2otu.xml +++ b/src/galaxy/multifasta2otu.xml @@ -1,10 +1,10 @@ <tool id="multifasta" name="Multifasta"> <description>Get Abundances on Multiple Files</description> - <command interpreter="bash">multifasta_to_otu -k $kmer -s $db -f <( echo + <command>bash -c "multifasta_to_otu -k $kmer -s $db -f <( echo #for $input in $inputs: -"${input}" +${input} #end for - | xargs -n 1 ) -o $output</command> + | xargs -n 1 ) -o $output"</command> <inputs> <param name="inputs" multiple="true" type="data" format="fasta" label="input fasta"/> <param name="db" type="data" format="data" label="trained database"/> diff --git a/src/galaxy/quikr.xml b/src/galaxy/quikr.xml index 89729be..65d604b 100644 --- a/src/galaxy/quikr.xml +++ b/src/galaxy/quikr.xml @@ -11,23 +11,7 @@ <data name="output" format="tabular"/> </outputs> <help> -**What it does** - -This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. - ------ - -**Example** - -Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: - - >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
>EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa - -Running this tool while setting **How many characters to keep?** to **14** will produce this:: - - EYKX4VC02EQLO5 108 - EYKX4VC02D4GS2 60 - - </help> </tool> + + diff --git a/src/galaxy/quikr_train.xml b/src/galaxy/quikr_train.xml index b5f5291..a33d866 100644 --- a/src/galaxy/quikr_train.xml +++ b/src/galaxy/quikr_train.xml @@ -9,23 +9,5 @@ <data name="output" format="data"/> </outputs> <help> -**What it does** - -This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. - ------ - -**Example** - -Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: - - >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
>EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa - -Running this tool while setting **How many characters to keep?** to **14** will produce this:: - - EYKX4VC02EQLO5 108 - EYKX4VC02D4GS2 60 - - </help> </tool> |