diff options
| author | Calvin Morrison <mutantturkey@gmail.com> | 2014-03-13 13:27:10 -0400 |
|---|---|---|
| committer | Calvin Morrison <mutantturkey@gmail.com> | 2014-03-13 13:27:10 -0400 |
| commit | 37a68001992200a855987955c651dec4adbe99b2 (patch) | |
| tree | 66011f01f023dfb375af2ce065dbf34e9cdd8bb0 /src/galaxy/quikr.xml | |
| parent | c4116bde303e76a56b59300fecbc21c1e4826efd (diff) | |
add basic working quikr functionality for galaxy
Diffstat (limited to 'src/galaxy/quikr.xml')
| -rw-r--r-- | src/galaxy/quikr.xml | 33 |
1 files changed, 33 insertions, 0 deletions
diff --git a/src/galaxy/quikr.xml b/src/galaxy/quikr.xml new file mode 100644 index 0000000..89729be --- /dev/null +++ b/src/galaxy/quikr.xml @@ -0,0 +1,33 @@ +<tool id="quikr" name="Quikr"> + <description>Classify with Quikr</description> + <command>quikr -v -k $kmer -s $db -i $input -o $output</command> + <inputs> + <param name="input" type="data" format="fasta" label="input fasta"/> + <param name="db" type="data" format="data" label="trained database"/> + <param name="lambda" type="integer" size="6" value="10000" label="lambda" help="default 10000"/> + <param name="kmer" type="integer" size="2" value="6" label="What mer size to use?" help="range 6 - 12"/> + </inputs> + <outputs> + <data name="output" format="tabular"/> + </outputs> + <help> +**What it does** + +This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. + +----- + +**Example** + +Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: + + >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
>EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa + +Running this tool while setting **How many characters to keep?** to **14** will produce this:: + + EYKX4VC02EQLO5 108 + EYKX4VC02D4GS2 60 + + + </help> +</tool> |