diff options
| author | Calvin Morrison <mutantturkey@gmail.com> | 2014-06-19 11:05:42 -0400 |
|---|---|---|
| committer | Calvin Morrison <mutantturkey@gmail.com> | 2014-06-19 11:05:42 -0400 |
| commit | 62067f0ca6db19fcdedc84476e68ba3864062f54 (patch) | |
| tree | 8a536647101c07115f1c7db3a450d0c36a015760 | |
| parent | 620e12d364148a0fbe8c60820a3c0a0f7c1561b9 (diff) | |
remove help flags
| -rw-r--r-- | src/galaxy/quikr.xml | 20 | ||||
| -rw-r--r-- | src/galaxy/quikr_train.xml | 18 |
2 files changed, 2 insertions, 36 deletions
diff --git a/src/galaxy/quikr.xml b/src/galaxy/quikr.xml index 89729be..65d604b 100644 --- a/src/galaxy/quikr.xml +++ b/src/galaxy/quikr.xml @@ -11,23 +11,7 @@ <data name="output" format="tabular"/> </outputs> <help> -**What it does** - -This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. - ------ - -**Example** - -Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: - - >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
>EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa - -Running this tool while setting **How many characters to keep?** to **14** will produce this:: - - EYKX4VC02EQLO5 108 - EYKX4VC02D4GS2 60 - - </help> </tool> + + diff --git a/src/galaxy/quikr_train.xml b/src/galaxy/quikr_train.xml index b5f5291..a33d866 100644 --- a/src/galaxy/quikr_train.xml +++ b/src/galaxy/quikr_train.xml @@ -9,23 +9,5 @@ <data name="output" format="data"/> </outputs> <help> -**What it does** - -This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. - ------ - -**Example** - -Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: - - >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
>EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa - -Running this tool while setting **How many characters to keep?** to **14** will produce this:: - - EYKX4VC02EQLO5 108 - EYKX4VC02D4GS2 60 - - </help> </tool> |