Merge branch 'master' of github.com:EESI/quikrHEADmaster

4 files changed, 12 insertions, 42 deletions

diff --git a/src/c/quikr_train.c b/src/c/quikr_train.c
index 08a1f0a..1260b86 100644
--- a/src/c/quikr_train.c
+++ b/src/c/quikr_train.c
@@ -34,7 +34,7 @@ int main(int argc, char **argv) {
 	unsigned long long position = 0;
 
   int verbose = 0;
-
+  int force_name = 0;
 
   char *fasta_filename = NULL;
   char *output_file = NULL;
@@ -45,6 +45,7 @@ int main(int argc, char **argv) {
   while (1) {
     static struct option long_options[] = {
       {"verbose", no_argument, 0, 'v'},
+      {"force_name", no_argument, 0, 'f'},
       {"help", no_argument, 0, 'h'},
       {"version", no_argument, 0, 'V'},
       {"input", required_argument, 0, 'i'},
@@ -55,7 +56,7 @@ int main(int argc, char **argv) {
 
     int option_index = 0;
 
-    c = getopt_long (argc, argv, "i:o:k:hvV", long_options, &option_index);
+    c = getopt_long (argc, argv, "i:o:k:fhvV", long_options, &option_index);
 
     if (c == -1)
       break;
@@ -73,6 +74,9 @@ int main(int argc, char **argv) {
       case 'v':
         verbose = 1;
         break;
+      case 'f':
+        force_name = 1;
+        break;
       case 'V':
         printf("%s\n", VERSION);
         exit(EXIT_SUCCESS);
@@ -117,7 +121,7 @@ int main(int argc, char **argv) {
     exit(EXIT_FAILURE);
 	}
 
-  if(strcmp(&output_file[strlen(output_file) - 3], ".gz") != 0) {
+  if(strcmp(&output_file[strlen(output_file) - 3], ".gz") != 0 && !force_name) {
     char *temp = malloc(strlen(output_file) + 4);
     if(temp == NULL) {
       fprintf(stderr, "Could not allocate enough memory\n"); 
diff --git a/src/galaxy/multifasta2otu.xml b/src/galaxy/multifasta2otu.xml
index b80f8b2..eebe246 100644
--- a/src/galaxy/multifasta2otu.xml
+++ b/src/galaxy/multifasta2otu.xml
@@ -1,10 +1,10 @@
 <tool id="multifasta" name="Multifasta">
 	<description>Get Abundances on Multiple Files</description>
-	<command interpreter="bash">multifasta_to_otu -k $kmer -s $db -f &lt;( echo
+	<command>bash -c "multifasta_to_otu -k $kmer -s $db -f &lt;( echo
 #for $input in $inputs:
-"${input}"
+${input}
 #end for
- | xargs -n 1	) -o $output</command>
+ | xargs -n 1	) -o $output"</command>
 	<inputs>
 		<param name="inputs" multiple="true" type="data" format="fasta" label="input fasta"/>
 		<param name="db" type="data" format="data" label="trained database"/>
diff --git a/src/galaxy/quikr.xml b/src/galaxy/quikr.xml
index 89729be..65d604b 100644
--- a/src/galaxy/quikr.xml
+++ b/src/galaxy/quikr.xml
@@ -11,23 +11,7 @@
 		<data name="output" format="tabular"/>
 	</outputs>
 	<help>
-**What it does**
-
-This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. 
-
------	
-
-**Example**
-
-Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
-
-    &gt;EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
    TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
    TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
    &gt;EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
    AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa
-
-Running this tool while setting **How many characters to keep?** to **14** will produce this::
-	
-	EYKX4VC02EQLO5  108
-	EYKX4VC02D4GS2	 60
-
-
 	</help>
 </tool>
+
+
diff --git a/src/galaxy/quikr_train.xml b/src/galaxy/quikr_train.xml
index b5f5291..a33d866 100644
--- a/src/galaxy/quikr_train.xml
+++ b/src/galaxy/quikr_train.xml
@@ -9,23 +9,5 @@
 		<data name="output" format="data"/>
 	</outputs>
 	<help>
-**What it does**
-
-This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. 
-
------	
-
-**Example**
-
-Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
-
-    &gt;EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
    TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
    TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
    &gt;EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
    AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa
-
-Running this tool while setting **How many characters to keep?** to **14** will produce this::
-	
-	EYKX4VC02EQLO5  108
-	EYKX4VC02D4GS2	 60
-
-
 	</help>
 </tool>