Train Quikr Matrix quikr_train -f -v -k $kmer -i $input -o $output **What it does** This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. ----- **Example** Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa Running this tool while setting **How many characters to keep?** to **14** will produce this:: EYKX4VC02EQLO5 108 EYKX4VC02D4GS2 60