From 62067f0ca6db19fcdedc84476e68ba3864062f54 Mon Sep 17 00:00:00 2001 From: Calvin Morrison Date: Thu, 19 Jun 2014 11:05:42 -0400 Subject: remove help flags --- src/galaxy/quikr.xml | 20 ++------------------ src/galaxy/quikr_train.xml | 18 ------------------ 2 files changed, 2 insertions(+), 36 deletions(-) (limited to 'src/galaxy') diff --git a/src/galaxy/quikr.xml b/src/galaxy/quikr.xml index 89729be..65d604b 100644 --- a/src/galaxy/quikr.xml +++ b/src/galaxy/quikr.xml @@ -11,23 +11,7 @@ -**What it does** - -This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. - ------ - -**Example** - -Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: - - >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa - -Running this tool while setting **How many characters to keep?** to **14** will produce this:: - - EYKX4VC02EQLO5 108 - EYKX4VC02D4GS2 60 - - + + diff --git a/src/galaxy/quikr_train.xml b/src/galaxy/quikr_train.xml index b5f5291..a33d866 100644 --- a/src/galaxy/quikr_train.xml +++ b/src/galaxy/quikr_train.xml @@ -9,23 +9,5 @@ -**What it does** - -This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. - ------ - -**Example** - -Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: - - >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa - -Running this tool while setting **How many characters to keep?** to **14** will produce this:: - - EYKX4VC02EQLO5 108 - EYKX4VC02D4GS2 60 - - -- cgit v1.2.3