From 37a68001992200a855987955c651dec4adbe99b2 Mon Sep 17 00:00:00 2001
From: Calvin Morrison <mutantturkey@gmail.com>
Date: Thu, 13 Mar 2014 13:27:10 -0400
Subject: add basic working quikr functionality for galaxy

---
 src/galaxy/quikr_train.xml | 31 +++++++++++++++++++++++++++++++
 1 file changed, 31 insertions(+)
 create mode 100644 src/galaxy/quikr_train.xml

(limited to 'src/galaxy/quikr_train.xml')

diff --git a/src/galaxy/quikr_train.xml b/src/galaxy/quikr_train.xml
new file mode 100644
index 0000000..b5f5291
--- /dev/null
+++ b/src/galaxy/quikr_train.xml
@@ -0,0 +1,31 @@
+<tool id="quikr_train" name="Quikr Train">
+	<description>Train Quikr Matrix</description>
+	<command>quikr_train -f -v -k $kmer -i $input -o $output</command>
+	<inputs>
+		<param name="input" type="data" format="fasta" label="input fasta"/>
+		<param name="kmer" type="integer" size="5" value="6" label="What k-mer size to use?" help="range 6 - 12"/>
+	</inputs>
+	<outputs>
+		<data name="output" format="data"/>
+	</outputs>
+	<help>
+**What it does**
+
+This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. 
+
+-----	
+
+**Example**
+
+Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
+
+    &gt;EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
    TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
    TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
    &gt;EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
    AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa
+
+Running this tool while setting **How many characters to keep?** to **14** will produce this::
+	
+	EYKX4VC02EQLO5  108
+	EYKX4VC02D4GS2	 60
+
+
+	</help>
+</tool>
-- 
cgit v1.2.3